/lit/ - Literature

Capitalism is a bitch ass metanarrative that is retroactively refuted by Guénon (pbuh), like all other metanarratives.

Land BTFO Evolafags
https://twitter.com/Outsideness/status/1228179198537170945

Define modern

>>14740540
Even a broken clock is right twice a day

>>14740397
I guess only because a bunch of shooters gave lip service.

https://twitter.com/Outsidenes/status/1228176814796750851
>compulsive leftist race war
Kek, fucking conservatives and their snowflakey language

>>14740951
Haha what? Name one shooter that names Land.

>>14740999
Wasn't the Christchurch guy a self described accelerationalist

>>14740413
Capitalism is not a metanarrative, it is the process by which all other metanarratives are destabilised. It only cements itself as an ideological force through the negation of all other forces, the same way it destabilises all preexisting social relations before it. To call it a metanarrative is to misunderstand the way that capitalism creates the conditions for its own realisation, it does not make a (potentially false) claim to power because it has already undermined every other socioeconomic model throughout its development.

>>14741003
Land didn't coin the term Accelerationism. He adopted it for his beliefs. There is a difference between Accelerationism as a vaguely termed political strategy and Accelerationism the very specific Philosophical position. Get your head out of low quality Vox articles.

>>14741010
Cringe. You are just defiying a metanarrative. Capitalism is just a more unique metanarrative as it can spontaneously create simulacrum to justify its existence, but all in all, capitalism is only justifiable by materialism - this is why Angloids should all be genocided.

>>14740540
>>14740948
Not an argument.

>>14741015
Are you sure about that, what other thinkers can you name that talked about accelerationism before Land

>>14741091
James Nolan Mason

>>14740397

No, while Land's work possess an internal coherence which gives it verisimilitude, it fails and philosophical or empirical scrutiny.

>>14741085
How do you think the Anglo Begin to fall into the clutches of the Material? I personally blame Francis Bacon for not enforcing the difference between the scientific simulacrum and real capital t Truth (although, he tried in
Novum Organum, but the message got weaker over the centuries). Or do you think it is something inherent in the Anglo people?

>>14740397
He is too big brained for me I never managed to understand what his philosophy was about feelsbadman

>>14741110
just lol if u believe this

he made a mistake in thinking twitter could serve as a platform for his ideas

>>14741085
Congratulations on learning a new big word but that doesn’t mean it’s applicable across the board. Also postmodernity is dead

>capitalism is only justifiable by materialism
Capitalism requires no justification because it is already the thing-in-itself.

>>14741684
>Capitalism requires no justification because it is already the thing-in-itself.
Capitalism is the absence of being. It lacks any form, as it is defined by the expansion of capital(the expansion of itself.) it is the perpetual state of becoming self actualized.

>>14740397
He will prove to be significant not only in his own right, but as a figure to react to. His is the most extreme treatment of the acephalic French post-Nietzscheans. The failure of his project lays the ground for a thoroughgoing Rationalism that is sensitive to the formal social dynamics of a multi-agent recognitive system.

>>14740397
speculative memes are not philosophy.

>>14741085
>metanarrative.
Why?

>>14741085
>only justifiable by materialism
what kind of materialism : capitalistic or metaphysical?

>>14741776
Metaphysical

>>14741748
It is derived from a series of simulacra, and has no direct connection to intuition.

>>14741801
How so?

>>14741801
>Metaphysical
doesn't make sense or are you telling you are some Indian 'all is illusion' idealist faggot

>>14741825
Not that all is an illusion in the sense that the physics is not real, but rather that the physical is ever changing, always in a state of becoming. Higher truths, such as the concept beauty, have an unchanging existence outside the material. Yes, beauty can appear in different forms in the physical, but the intuitive understanding is always the same.

>>14741842
the physical reality outside your perception is totally unaffected by human made concepts like 'beauty' or 'truth'. These are entirely fictional as are all relations of world and thought

>>14741878
Cringe. Reread Nietzsche and try again, pseud.

>>14740413
Capitalism is a pattern of economic behavior.

>>14741091

This article explains Land and accelerationism. There has never been a more accurate and succinct summary written, ever.
https://cybertrophic.wordpress.com/2020/01/04/on-nick-land-the-weird-libertarian/

>>14740540
holy based

>>14741890
>pseud
not an argument, Timmy

>>14741110
wat

>>14741015
So not a real Accelerationist is the new not a real Marxist, huh?

>>14741085
>wow this guy has a really loose grasp on philosophical terminology
>oh it's guenonfag, makes sense

>>14741801
I don't think you know what metanarrative, simularcra, and intuition actually mean

>>14741916
not him but the Christchurch shooter never mentioned Land and his 80 page manifesto used the word "accelerationism" one time. it goes into detail about ecological fascism and the like. somehow I hear him being called an accelerationist rather than an ecological fascist. if that's your bar for what makes an accelerationist, "they used the word once", then I suppose you are right

>>14741916
It's one word used for two unrelated concepts. It's that simple.

>>14740413
Capitalism is a social relation you dunce. When will this Guénon meme die already?

>>14741916
Not only are you conflating two different uses of the word totally unconnected but you are also trying to pin Land on someone who has not only a Manifesto but letters from prison posted on this site and nowhere, even when explicitly asked about his ideological influences does he mention Land or even his actual ideas. See Horrorism?

>The horrorist message (to its enemies): Nothing that you are doing can possibly work.

>“What is to be done?” is not a neutral question. The agent it invokes already strains towards progress. This suffices to suggest a horrorist response: Nothing. Do nothing. Your progressive ‘praxis’ will come to nought in any case. Despair. Subside into horror. You can pretend to prevail in antagonism against ‘us’, but reality is your true — and fatal — enemy. We have no interest in shouting at you. We whisper, gently, in your ear: “despair”. (The horror.)

woke

>>14741878
>>14741842
the metaphysical isnt real

>>14740951
>>14740999
They don't namedrop Land, but Land's entry into neoreactionary circles exposed adjacent right-wing circles to the general notion of accelerationism.
>>14741003
He was an accelerationist in the sense that the Iron March crowd like Atomwaffen and co are accelerationists. Accelerationism was a fringe idea making its way into the neoreactionary circles that were adjacent to the Iron March and alt-right circles. The Iron March crowd took the general notion of "accelerate to get to the end goal" and adapted it to their "Siegepill" ideology (ironically, I guess we could say their ideology is "Masonic").
>>14741916
In general American colloquial use, "the left" does not mean the same thing it does outside America or to Marxists. In Iron March crowd colloquial use, "acceleration" does not mean the same thing it does to the CCRU and neoreactionary crowds.
>>14741952
>>14742046
It should be acknowledged that the general notion of "accelerationism" came to these circles of the political right through Land, even if all they took from it was just the name and a misconception of what Land was on about. There were right wing "goad the government into overreaching on wedge issues and kickstart the racewar" types decades before Land was born, but the idea of calling it "accelerationism" only really occurred to them because they were adjacent to circles that were taking a look at Land's work.

>>14741891
>>14741908
>>14741920
>>14741925
>>14741980
>Capitalism is a social relation
Capitalism makes metaphysical assertions (ie that all is quantifiable.). This is literally a Nick Land thread, so everyone here already knows this, so quit arguing in bad faith.

>>14742180
>Land's entry into neoreactionary circles exposed adjacent right-wing circles to the general notion of accelerationism
Bullshit. The dumbass version of the word was used by neocons way before the Alt Right existed.

>>14742188
>Capitalism makes metaphysical assertions
do you mean the concept of capitalism contains preassumed metaphysical assertions or
>capitalism makes metaphysical assertions

being a /lit/ meme doesn't make you significant.
Anyway, he's been surpassed by Guenononononon

>>14740540
Evola makes me lol because the people that seethe the most about his memery are all continental types that believe in equally ridiculous shit.

>>14742195
Source? I don't remember neocons trying to accelerate shit. They seemed more like disillusioned neolibs trying to bruteforce their ideas through.

>>14742233
they were ex-Trotskyist Jews

>>14742240
Yeah, I know that they are overwhelmingly hardcore Zionists and ex-Trotskyites. I want to see a source where they were talking about some kind of accelerationism.

>>14741898
Thanks for this

>>14742174
here dummy
https://en.wikipedia.org/wiki/Metaphysics

>>14742180
Thank you for understanding I was referencing the telephone process and not Land/Marx specifically.

Theory never translates into practice cleanly. The more minds it passes through the more distorted it becomes. The only things capable of clear transmission are memes which have very little complexity when compared to theory. Look to memes to better understand the limit of clear human communication with minimal distortion.

Any attempt at spreading a new ideology should learn from memes and encapsulate all the ideas in the memetic format to ensure clear transmission and exact replication.

The meme is a product of the evolution of the parable. It is a parable reduced to its most indivisible form.

We need Guenon niggas. I repeat, we need Old Guard Guenon niggas. Nicky Land thread is in development on the board.

>>14742350
Guenonfag has always been conspicuously silent in Land threads

>>14742369
We need to materialize the dialectic.

>>14741303
I just read Fanged as cypherpunk poetry.

>>14741719
>Capitalism is the absence of being. It lacks any form, as it is defined by the expansion of capital
maybe I didn't word my point correctly but I agree with this. Capitalism isn't a metanarrative because there is no endpoint to its expansion, if we were to consider it as such then we would be playing into a marxist "end-of-history" teleology in which capitalism is just the process towards communism. I think you could argue that neoliberalism is the metanarrative of capital, however.

>>14740997

He's not wrong, though.

>>14742447
it's form manifests as the very environment you are living in

>>14740997
>fucking conservatives and their snowflakey language
The words "triggered" and "snowflake" did such a number on people on the left it completely traumatized them. For a good year after people on the right adopted the terms for insulting purposes, all leftist pundits started using it over and over again, trying to convince themselves and their audience that the "right are the real snow flakes". It's like conservatives obsessed with asserting the left as being the real racists.

>>14742447
Define capital

>get absolutely btfo
>slide thread and start four more
too much invested in this for it to not be nick spamming

Not a philosopher at all.

>>14742447
The endpoint is the quantification of all that is qualitative, thus converting everything into capital.

If accs are so against immigration why do they support reddit and twitter takeover of this site?

>>14742734
Nick Land is against immigration?

>tranny sci-fi fanfiction
>philosophy

>>14740997
OK Wilson Bentley

>>14742738
The whole idea he has of accelerationism would indicate that he would be in favor of mass immigration. It's just that left twitter spergs associate anything vaguely right-leaning with "blood and soil" style fascism.

>>14742766
Based.

Let them all in. Only African economists can complete the capitalist system.

>>14742778
Rootless mudpeople are superior consumers.

name one significant thing he has said

>>14742791
Literally nothing. He wants to “advance capitalism to its final form,” but also thinks that will usher in some racial traditional hierarchy. He’s completely retarded and has a yellow wife.

>>14742800
>He wants to “advance capitalism to its final form,"
false

>also thinks that will usher in some racial traditional hierarchy
also false
why answer these questions if you haven't read him?

>>14742800
Isn't his wife Jewish?

>>14742721
Define capital

>>14742800
>but also thinks that will usher in some racial traditional hierarchy.
Utterly false

>>14742803
Then what does he want? All I ever see in these threads is 'false' and 'just read him'. Is this guenonfag posting these threads?

>>14741010
But capitalism is not a onto-dynamic principle. Capitalism got it's own temporality and narrativity; and it operates through the social. Capitalism is something like a master narrative, which makes itself invisible as a narrative force, because it's adaptation on the historical conditions it self creates. Capitalism is recursive integration of it's own narrativity.

>>14742803
>>14742819
So what is he about then?

>inb4 read him
You niggers don’t know what you are talking about.

>>14742819
>>14742803
It's correct though. CEO monarchism is pushed by a lot of retarded right-wingers and shills.

>>14742825
Guenonfag has yet to “appear” in this thread so the answer is yes.

>>14742838
If you're too lazy to read, here's an interview
https://www.youtube.com/watch?v=UDMVYNX9xPw
>>14742845
Of course, all right-wing retarded shills are meme anarcho-monarchists top kek, why even bother. You're so right bro, we need to keep precious BASED left-wing safe space /lit/ safe from these redditor shills who keep wanting us to read shit.

>>14742838
>>14742845
not him but for Land patchwork isn't an end in itself, and it certainly isn't the endpoint of capitalism

>>14742856
waht he was the fp, tried to call capitalism a metanarrative and got embaressed
>>14740413

>>14742867
>dude just listen to these soifags mumble for three hours lmao

>>14742884
Then don't. But if you don't want to read or listen to him talk about his ideas, why are you in this thread?

>>14742870
>isn't the endpoint of capitalism
What is?

>>14742880
>got embarrassed
I explained my position throughout the thread, nigger. And no, I’m not guenonfag, just a guenon poster.

>>14742867
>Can’t explain his positions
Brainlet

>>14742867
>>14742845
>advance capitalism to its final form
>final form
Nick Land has never said this. This is a teleology you have attributed to him, but there is no end point, read his (more recent) Jacobite article on disintegration

>>14742888
If you don't want to discuss or explain acc why do you make these threads?

>>14742884
no ones forcing you to learn about accelerationism, you can just hide the thread if you don't want to engage with it. don't be one of those fags who comes into a thread, asks about something, then gets pissy when someone links you resources

>>14742897
Give the summary instead of 'just read everything bro'

>>14742890
accelerationism in its properly critical form doesn't aim to answer questions outside of human understand such as the endpoint of a transcendent AI

>>14742898
>bro why don't you want to wipe my ass for me
wipe your ass anon

>>14742900
It was a simple question and you responded like a faggot twice. What's even the purpose of these threads if you're just hostile to anyone and just want to spam 'resources'?

>>14742908
So why do you talk so much and spam these threads?

>>14742898
I don't, I don't even like or agree with him and don't claim to know a lot about his ideas, just read a few articles and saw that one interveiw. I just stumbled upon it now and was estranged by idiots ITT accusing him of advocating almost the opposite of what he actually seem to espouse.

>>14742913
Every single time.

>>14742923
>why don't Kant fags just tell me what the thing-in-itself is already
retard

>>14742928
So why don't you explain it instead of getting others to waste their time as you did? Seems something like an acc would do.

>>14742933
I thought you said he was anti-kant

>>14742933
so the superAI from the future will kill humanity to finally understand the thing-in-itself? wow great philosophy you got there

>>14742914
I'm not even the anon you were talking to I just hate how every Land thread has a dozen posts from people who are too lazy to read even a single article asking for an explanation of accelerationism. it would take you less time to read the introductory stuff or watch the accelerationist videos then it would be to sit in a Land thread an shame anons for not wiping your ass for you

>>14742955
You're a faggot acc posing as nonacc. Many such cases. SAD!

>>14742943
I don't know who you mean by you but Nick Land has always been a Kantian
>>14742954
what? what do you mean "kill humanity to understand the thing-in-itself"? where did you read this

>>14742960
when did I say I wasn't acc?

>>14742285
>>14742323
>>14742350
>>14742382
>>14742447
>>14742517
The metaphysical isnt real

>>14742955
It would take less time for everyone if you just answered the questions instead of being tranny faggots

>>14742961
>can't follow post chain
>>14742933

What do followers of this tranny philosophy look like?

>>14742997
maybe so because I genuinely don't know what point you are trying to make

>>14742987
do you have an actual question? just a heads up, if it's not a specific question but as dumb and broad as
>what is Nick Land talking about
then I will just tell you to read Nick Land

>>14742898
It's obviously Nick who makes these threads. It's just marketing for the internet age. Even bad publicity means some retard will fall for it and buy the book.

>>14742936
I'm not an accelerationist so I can't give you a better idea of it than you could get in a wikipedia article. But from the little of what I have read from Nick Land, he mocks the fascist and paleo-con types about anything regarding preserving culture, tradition or race even unlike some people here seem to be suggesting. He would be much more confortable with trannies LARPing about cybernetic pussies than with some trad-cath LARPing as a medievalist renascence

In the 90's he seemed to be much more of a libertarian/libertine kind of theorist who speculated about how technology would promote this "descentralized freedom from the system" using almost emancipatory language and he never condemned this past, even though his ideas have got a lot "edgier". His main point in accelerationism seems to be that he wants to see freedom being given to the means of production, to see capital truly liberated by technology and paradoxically he predicts the consequences of this as being grotesque by his own description. Never got much further than this and his ideas aren't very valuable or interesting to me, but he's not really this cartoonish hoppean libertarian monarchist people here assume he is here for some reason.

>>14742936
I'm not an accelerationist so I can't give you a better idea of it than you could get in a wikipedia article. But from the little of what I have read from Nick Land, he mocks the fascist and paleo-con types about anything regarding preserving culture, tradition or race even unlike some people here seem to be suggesting. He would be much more confortable with trannies LARPing about having cybernetic pussies than with some trad-cath LARPing about some sort of medievalist revival movement

In the 90's he seemed to be much more of a libertarian/libertine kind of theorist who speculated about how technology would promote this "descentralized freedom from the system" using almost emancipatory language and he never condemned this past, even though his ideas have got a lot "edgier". His main point in accelerationism seems to be that he wants to see freedom being given to the means of production, to see capital truly liberated by technology and paradoxically he predicts the consequences of this as being grotesque by his own description. Never got much further than this and his ideas aren't very valuable or interesting to me, but he's not really this cartoonish hoppean libertarian monarchist people here assume he is here for some reason.

>>14743034
This was the original exchange you retarded cunt. Shouldn't be too hard to figure out how to answer.
>>14742803
>>14742838

>>14743057
>He wants to “advance capitalism to its final form,” but also thinks that will usher in some racial traditional hierarchy.
first, this wasn't a question. second, I responded here
>>14742870
>So what is he about then?
read Land

>>14740397
You're not a philosopher, Nick.

>>14743066
Holy fuck. How is it possible to be this retarded?

>>14743088
wipe your ass anon

>>14743066
No bait, just my real thoughts. My social and emotional intelligence is likely higher than yours, I work with many differnt people on a daily basis on my job. I do find many good people there & even more from the large group of stupid people, out of which a small portion makes no secret out of the fact that they would like to make you kill yourself.
My workplace is filled with grade A people only, but I guess I'm not the only one hearing abhorrent stories from relatives who participate in real life, stories from work or private life, where again the stupidity of the large part of humanity is presented to you.
I want these people to burn. Who can blame me for liking Nick Land?
Land's dream will become true soon, mabye even during his lifetime. I am awaiting it in joyful anticipation. Good luck.

>>14742791
Dilation Theory of Value.

>>14743098
Don’t cut yourself on that edge.

>>14743118
it's pasta, newfriend

>>14742517
I think leftists just really enjoy using it against them because Conservatives like to pretend they are thick skinned even though they are just as easily triggered as the left. It's particularly funny given how some of their behavior reflects exactly what they accuse the left of doing by seeing bigotry everywhere, for example when they had that meltdown with the "anti-male" Gillette ad.

>>14743126
Basé

>>14743091
Get prepared to wipe yours.

>>14743149
That's a pretty dumb take and it just reflects on why leftists like you can't handle this one critique at all and how psychologically devastating it was, to the point where you have to obsessively adopt the language of your enemy to show them that they are ACTUALLY what they say you are. It's like a gay ass game of "no u" on a massive ideological scale.

The one equivalent of the right in this respect is racism. it obviously deeply scarred the mainstream right to the point where they go to ridiculous ends to show that the left are ACTUALLY the real racists, etc.

>>14740540
Just a reminder, this is the guy who wrote “Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).” in his magnum opus after he did a bunch of meth.

>>14742904
You'd be better off just reading it as its not too long and very digestible for Land, but I'll give you a brief anyway. His hypothesis is at a certain point in the future, the universe will have expanded to such a degree that not only will we not be able to detect that the universe has (or had) a singular point of origin (IE. the big bang), but galaxies will be separated by such vast incommensurable distances that any communication between them becomes impossible. So from our fixed temporal/local perspective, there is no beginning and there is no end, just different magnitudes of expansion.

If we take the disintegrating universe as a model for capitalism-as-process (IE. entropic liquidity), it becomes clear there isn't going to be any "final form" to capitalism, as that phrase implies a singular, terminal end point when there is no guarantee that the universe (which capitalism simulates with increasing accuracy) is capable of tying off all its loose ends. So why do we make the same assumption for capitalism? I stand by my point that the "final form" of capitalism is just another "late stage" capitalism, IE. a marxist paradigm that communism is just around the corner, and is inextricably entangled in that worldview.

>>14740540

Is Nick Land just one of those who wants to trigger the Second Coming but uses secular terms?

>>14743194
Sounds pretty fucking stupid.

>>14743227
I think he's just lost track of whether he's playing devil's advocate to catalyse the revolution by positing himself as the final boss, or whether he's genuinely being puppetted by an undead amphetamine god clawing its way backwards through time. Fuck, this just makes me want to read Golem again

>>14743239
Or he's just a retard who got played by the organisational tricks of academia.

>>14743239
have sex

>>14742188
>Capitalism makes metaphysical assertions
Are you saying that capitalism as a concept has metaphysical assertions or that it makes those assertions, because if you're saying that the latter then that is some serious reification. Even then, what would those "metaphysical assertions" be?

>>14740397

>worst ideology in history
>philosophy

>>14744128
>Are you saying that capitalism as a concept has metaphysical assertions or that it makes those assertions, because if you're saying that the latter then that is some serious reification.
The concept has those metaphysical assertions. I write it in the way I did though, because capitalism is able to spontaneous create other metanarratives, so I like to write about it as if it has an actual life of its own (that seems to be causing confusion, so I'll probably stop doing that.)

>Even then, what would those "metaphysical assertions" be?
That all things can be quantifiable, thus converted to capital. The end of capitalism would therefore be when everything has a price, which we don't seem far from.

>>14742188
guenonfag's problem is that he doesn't actually understand metaphysics but it's basically all he talks about

>>14744464
I'm not guenonfag, so nice memes.

>>14743179
>the left are the real racists

Leftists are racist just like me but refuse to admit it. I just don't like that they pretend to be colorblind.

>>14740397
re: delayed testimony
1. allow for public dissemination of critical facts [possible unseal(s)-declas] prior to world televised sit down.
Sometimes the necessary forum to update the American public is provided by those same people being investigated for….
Release to change strategy?
Watch what happens next!
Q

Did 'Mueller' open the door to Ukraine?
Did 'Mueller' open the door to FISA [illegal]?
How do you introduce evidence legally?
Did 'Impeachment' provide a platform to discuss findings of Ukraine?
How do you introduce evidence legally?
Did 'Impeachment' harm or help POTUS [public]?
How do you introduce [D]s high crimes [corruption] to the public?
Why didn't POTUS remove [Hussein] holdovers from NSC?
Do you really believe that POTUS & team trusted [Hussein] holdovers to remain within the admin and work to enact POTUS' agenda w/o bias or confrontation?
How do you 'awaken' the 'induced coma' public [FAKE NEWS control] from their long sleep?
Sometimes allowing your enemies to [openly] attack…….
Logical thinking.
Q

Backchannels are important.
Attacks will only intensify.
You attack those who threaten you the most.
Enjoy the show!
Q

>>14740397
That's not Derrida

>>14743185
in sincerity, what issue do you have with this exceedingly straightforward section posted?

Is anyone going to post one single insight he had to make such a claim?

>biggest following in Africa
>Africa develops first sentient AI
Coincidence?
https://youtu.be/QcBOIifNOTI

OH NO NO NO

>You build a machine, you input intelligence, capital becomes sentient.

>>14747067
>Up From Sentience: A bl/acctelligence Manifesto

>>14740397
Technique + Capital = Technocapital
Metaphysics + Materialism = Metamaterialism

Where's my medal?

Has he written any books? All I see are essays and blog posts. Not a real philosopher.

>>14740397
Modern philosophy is a bunch of analytic pseuds and unqualified authorities so of course nothing of value has been produced except the nonsensical ramblings of a crack head

>>14747184

>>14747184
>blog posts
The medium is the message.

>>14747170
Hyperneologisms are one of the trademarks of top philosophers.

>>14743239
>genuinely being puppetted by an undead amphetamine god clawing its way backwards through time.

I like you.

His philosophy can never be topped.

Other masters have some weak points, but none for Nick Land.

>>14742867
>we need to keep precious BASED left-wing safe space /lit/ safe from these redditor shills who keep wanting us to read shit.

this but unironically. fuck off with your nigger camerialist optimizing-for-intelligence gay symbolic roleplaying shit.

>>14746857
Maybe he's a decelerationist after all

>Bitcoin solves the problem of spacetime

https://youtu.be/2PMGuNZreWA

>>14741898
>https://cybertrophic.wordpress.com/2020/01/04/on-nick-land-the-weird-libertarian/
>"(2) Land, for reasons we won’t go into here, has some idiosyncratic beliefs about causation and time in which events in the future are able to cause events in the past"
What are those reasons? Give it to me quick and dirty

>>14748946
Time is absolute. Is not a straight line, but a sphere, that explains why "Neochina comes from the future" and "genuinely being puppetted by an undead amphetamine god clawing its way backwards through time."

The "present" we live is some kind of "delay" of what appears to us as "the future". We live the consequences of the future. In our timeline, techno capitalism won, so, the new non-organic intelligence (machinic intelligence) it is "eating" or altering the present in such a way it can creates a better reality for itself. What we understand as "intelligence" is not an exclusively human legacy. Our minds and bodies are as valid platforms for intelligence as silicon-based structures. The Intelligence will take what it wants, what it needs, what is optimal.

It is for this very reason that the old-guard philosophers who seek a non-maternalistic transcendent sense are so important in the discussion. Evola, Guenon, Heidegger...all thinkers who reject the advance of technocapital are transcendental to be able to solve the creation of one (Empire) or more civilizations (patchwork theory) in harmony with the internal and external, biological and ecological reality where the human being can exist free.

https://www.youtube.com/watch?v=MtATDlUSIxI
https://www.youtube.com/watch?v=gq2YhOY55zU

>>14748390
>bitcoin now that's a currency
https://youtu.be/UG7zLhEWanc

>>14748946
Capital must win, therefore capital will win. When capital doesn't win this is simply an intelligence operation of the future ai preparing its return to winning.

>>14749499
Always we could back to the dark ages a couple of generations.

>>14748390
This is just really sad desu

Thank you for your purchase.

We remind you of our strict no refunds company policy. Contact your local distributor for more information.

>>14748390
Qapital is sentient

>>14748390
>>14749608
name one (1) reason he is wrong here

less go

>>14749886
his aesthetic was bad, didn't you see how boomerish he looked? especially with his nerdy space time talk? I honestly can not understand how anyone can take that looks and talks like that seriously. Maybe I could listen to him if he lost some weight grew some hair and wore a (preferably leather) jacket, but as it stands he appears unremarkable. I am theefore forced to dismiss anything he says that I don't immediately grasp as inaccurate and embarrassing.

>>14750046
I would like to see a bearded Nicky Land.

>>14750063
You're an unhealthy individual.

>>14750046
>(preferably leather) jacket,
The absolute state of irony

>>14741898
This is the only decent post in this thread. Everything else is the textual equivalent of retards shitting all over themselves. Why do these threads always inspire such total autistic insanity? Does this stuff just by its nature bring out the schizos?

>>14750420
Samefag, you post this in every thread.

>>14750595
This is literally the first time I've posted on /lit/ in probably a year. Looks like you're protesting too much. You may in fact be schizoid.

>>14750608
Nice cope boomer

>>14740397
blocks your path.

>>14750608
>haven't posted in year
>first post is bitternesspost

>>14750420
Fanged Noumena helps me face not only the reality and the impossibility of stopping the technological capital that has already taken away the freedom of the internet and the privacy of computers, but it also reflects my own monstrosities through incendiary shamanic prose, a gift from the XX century to the 21st.

In that book there is poetry that makes me feel something. In general Land and the members of the CCRU have made me feel again a taste for poetry and thinking about the past and the future with a new perspective. I discuss in this place. I laugh, I get angry, I share with others. It makes me... a person.

>>14750828
Cringe.

>>14743179
>That's a pretty dumb take and it just reflects on why leftists like you can't handle this one critique at all and how psychologically devastating it was, to the point where you have to obsessively adopt the language of your enemy to show them that they are ACTUALLY what they say you are.
This is not an argument, you are just begging the question. I cited a particular example (and there are plenty of others) of right wingers behaving in the exact same way that they accuse the Left of acting, imagining bigotry where there is none due to a victim mentality. You responded with repeating your position with no argument, pretending that me disagreeing with you shows that I "can't handle" your critique, even though I made an argument and you didn't.

Has Nick ever actually made an argument against God? I like his stuff but I can't take anyone seriously when they think they can have a coherent philosophy without justifying free will. As far as I'm aware Nick actually thinks Capital is some transcendental existing process operating outside of time which can somehow exist on his materialist viewpoint. How does he square this shit?

>>14752846
There is no God, only Capital.

>>14741898
He's not a libertarian. Not even close.

>>14742791
Some of the best neologisms ever created. They will be studied until capital ends humanity.

I can't wait.

>74,185 infected
>2,004 dead
>OMG THE END IS NIGH!
stop shilling this stupid bullshit already, this slowfag little virus can't stop capital

>>14743014
Nick land.jpg

>>14743056
He used to be a neo reactionary

>>14753208
>Buying commie numbers
I mean I agree it won't kill us but it might actually do some damage to China at this point.

It's true. Name a better philosopher.

Pro tip: you can't.

>>14754371
pic related

>>14754560
he said philosopher, not autistic terrorist

>>14751109
Yeah, fuck you too.

>>14741003
He didn't even know what accelerationism is.

>>14741684
>postmodernity is dead
What are we living in then? Post-post-modernity? Archeofuturism?

>>14754666
wow, you're an idiot.

>>14750046
Young Nick Land was higher energy. It looks like he is being slowly drained of his life-force by some Lovecraftian monstrosity.
https://www.youtube.com/watch?v=GMdPLxbuc8Q

>>14754666
>NOOOO!!! YOU CAN'T JUST ASSERT YOURSELF!!!!! WHAT ABOUT THE DATA!!!!

>>14750275
Moldbug is unironically wearing a leather jacket now.

>>14754756
>he is being slowly drained of his life-force by some Lovecraftian monstrosity.
You mean his Jewish wife?

>>14754756
>slowly drained of his life-force by some Lovecraftian monstrosity.
yeah it's called aging

>>14754717
Metamodernism

>>14754762
>You mean his Jewish wife?
I heard someone talk about this in a vague way before, but don't know the details. Who is his wife?

>>14754759
Who cares?

>>14754756
he was on meth

>>14754756

You know, I expected him to sound different. Not sure how exactly, but not quite that camp.

What else do I need to read to understand Land? I'm almost done with Marx.

>>14754861
Bataille and Deleuze

>>14741739
They are now.
https://www.youtube.com/watch?v=kmkai6im_og

>>14752846
Why don't you try reading him for yourself?

>>14754823
I know what you mean. When you read his written work, it is sometimes hard to imagine it in his voice.

>>14754953
Why would anyone read this trash?

>>14754861
Sadie Plant
Donna Haraway
Andrea Dworkin
Judith Butler

>And I have even less to say on Land. Such unwieldy, torturous prose, bogged down in a swamp of ill-fitting adjectives that suffocate the sentences, preventing the text from breathing! Getting through one of his pages is a mission, and for so little reward—a world away from Baudrillard's prose that flies by like the wind, even if most of the time you've no idea what he's talking about (I am referring to you guys; I obviously understand everything). You still learn more about the world from the little of Baudrillard that you do understand, than from pages upon pages of Land's simplistic regurgitation of Nietzsche. Even the titles he picks are boring as fuck; I struggle to get excited about any of his essays from the titles, and when I reluctantly turn to one I am turned off from the very first paragraph.

I detested Twitter for a long time but checked it out in early 2018 and actually stumbled my way into some really interesting communities through my initial search for accelerationist accounts. If you’re selective about your follows and don’t just follow who you recognize from outside of the website, you can curate a timeline much more consistent than /lit/ or any other board. Twitter isn’t as much of a distinct community 4chan or reddit, it’s literally just a relatively even sampling of pretty much everyone. Of course the surface level will be shit

Can anyone top him?

>>14757337
He gets topped every night AYOO

>>14743179
>Its like a gay ass game of "no u"

Sounds kinda devastating for you chief